Electronic Journal of Biotechnology ISSN: 0717-3458
  © 1999 by Universidad Católica de Valparaíso -- Chile
Vol. 2 No. 3, Issue of December 15, 1999
 

 

Table 1. Characteristics of oligonucleotides used in degenerate and inverse PCR reactions

Primer

 

bp

Sequence 5' - 3'

Tma (° C)

%GC

IPGIPL

IPGIPR

AP-PGIP-INVL

AP-PGIP-INVR

AP-PGIP-INVL-2

AP-PGIP-INVR-2

23

24

25

25

22

21

CGAATTCC(C/A)GC(C/T)AT(C/T)GC(T/C)AA(A/G)CT

CAGGATCC(C/T)TC(C/G)AGC(A/T)TGTT(C/A)CG(A/T)

AGACCGCAATAAGCTCACAGGTCAT

AGGTTCTTGAGTTGGCTGAGGAAGT

ACCTCATTCGCTCAGATGGACT

TAGGTATTGCATTCGGCCTCG

 

NDb

ND

74

74

66

64

ND

ND

48

48

50

52

a Tm calculated using formula: Tm = 4(GC) + 2(AT)

b ND, not determined

Supported by UNESCO / MIRCEN network