EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2012 by Universidad Católica de Valparaíso -- Chile
Vol. 15 No. 1, Issue of January 15, 2012
 

Table 1. Primer sequences, primer concentrations, product sizes and annealing temperatures for amplification of putative Cyclamen persicum GST genes.



Abbreviated gene designation

Putative gene
product

GenBank

No. Cyclamen EST databased

Forward Primer (F)
Reverse Primer (R)
5' → 3'

Product size [bp]

Primer
concentration [nM]

CpGST1

Probable glutathione S-transferase parA

AJ886042

CYC01T7_E12

F: CATCCTGGGAGAACAATGTG
R: ACCCCCAAAGTAGGGTTTGT

118

200

CpGST2

Probable glutathione S-transferase

AJ886910

CYC32T7_B11

F: GCTCGGGATTTTGCTAGAAG
R: TTCCCTGATGACAGAGCAAT

109

200

CpGST3

Glutathione S-transferase GST 20

AJ887722

CYC29T7_E07

F: GTTGGGACCGATCGAAGTA
R: CAAGTGGAAGCTCGAGGAA

101

200

CpGST4

Glutathione-S-transferase/glutaredoxin

AJ887143

CYC16T7_B04

F: AAGGGCATGAGGTGGATTT
R: CTCATCAGCCTCGCTATGG

98

100

CpGST5

Putative glutathione S-transferase

AJ886941

CYC33T7_F07

F: TGTGAAGCTGCTCGATGAA
R: TGGGATCGCATTTTTCACT

91

100

Ef-Tu

Elongation factor tu

AJ886626

CYC16T7_A05

F: TATCCAGAGGGGGATGGTT
R: TGCCTACCTCCCTCTTCCT

102

200