EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2011 by Universidad Católica de Valparaíso -- Chile
Vol. 14 No. 3, Issue of May 15, 2011
 

Table 2. Primer name, sequences, PCR annealing temperature, expected product size and references from Lr gene associated markers used in this study.



Gene

Name

Primer sequences (5'-3')

Annealing temp. (ºC)

Product size (bp)

Reference

Lr9

J13/1

TCCTTTTATTCCGCACGCCGG

55

1110

Schachermayr et al. 1994

J13/2

CCACATACCCCAAAGAGACG

Lr10 

Lrk10D1

GAAGCCCTTCGTCTCATCTG

55

282

Schachermayr et al. 1997

Lrk10D2

TTGATTCATTGCAGATGAGATCACG

Lr19 

GbF

CATCCTTGGGGACCTC

60

130

Prins et al. 2001

GbR

CCAGCTCGCATACATCCA

Lr20 

STS638-L

GCGGTGACTACACAGCGATGAAGCAATGAAA

60

542

Neu et al. 2002

STS638-R

GCGGTGACTAGTCCAGTTGGTTGATGGAAT

Lr21 

F

CCAAAGAGCATCCATGGTGT

54

885

Huang and Gill, 2001

R

CGCTTTTACCGAGATTGGTC

Lr24 

J09-1

TCTAGTCTGTACATGGGGGC

55

350

Schachermayr et al. 1995

J09-2

TGGCATGAACTCCATACG

Lr25 

Lr25F20

CCACCCAGAGTATACCAGAG

50

1800

Procunier et al. 1995

Lr25F19

CCACCCAGAGCTCATAGAA

Lr26 

IB-267L

GCAAGTAAGCAGCTTGATTTAGC

55

267

Mago et al. 2002

IB-267R

AATGGATGTCCCGGTGAGTGG

Lr29 

Lr29F24

GTGACCTCAGGCAATGCACACAGT

55

900

Procunier et al. 1995

Lr29R24

GTGACCTCAGAACCGATGTCCATC

Lr34 

csLV34F

GTTGGTTAAGACTGGTGATGG

55

150

Lagudah et al. 2006

csLV34R

TGCTTGCTATTGCTGAATAGT

Lr35 

Lr35F

AGAGAGAGTAGAAGAGCTGC

55

900

Gold et al. 1999

Lr35R

AGAGAGAGAGCATCCACC

Lr37 

URIC

GGTCGCCCTGGCTTGCACCT

60

285

Helguera et al. 2003

LN2

TGCAGCTACAGCAGTATGTACACAAAA

Lr47 

PS10L

TCTTCATGCCCGGTCGGGT

60

224

Helguera et al. 2000

PS10L2

GGGCAGGCGTTTATTCCAG

PCAPSR

CGTGAGACTCGCCGTTACCTTG

Lr51

S30-13L

GCATCAACAAGATATTCGTTATGACC

52

422 + 397

Helguera et al. 2005

AGA7-759R

TGGCTGCTCAGAAAACTGGACC