EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2011 by Universidad Católica de Valparaíso -- Chile
Vol. 14 No. 2, Issue of April 15, 2011
 

Gene sequence 1. Sequencing of the seaming sites: sequence annealing to Fluc gene was shown in boldface; sequence complementary to insertion site on pRL-TK was underlined.



Seq.1 (sequencing primer SF: GATGCACCTGATGAAATGGG )

TTTTTAAATCCAATTCGGTTGAACGAGTTCTCAAAAATGAACAATAATTCTAGATTCCGAGATATCGGTAATGGGC
CCTAGAGCGGCCGCTTCGAGCAGACATGATAAGA
TACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGA
AAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTA
ACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCT
CTACAAATGTGGTAAAATCGATAAGGATCCAGGTGGCACTTTTCGTGCGATCTGCATCTCAATTAGTCAGCAACCA
TAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACT
AATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTT
GGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGGAAGACGCCAAAAACAT
AAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGA
TACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCG
AAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGA
AAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATT
TATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGTTGCA
AAAAATTTTGAACGTGCAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGG
GGATTCAGTCGATGTACACGTCGTCACATCTCATCTACCTTCCCGGTTTATGATACGATTTTGTGCAAGAGTCTTC
GATAGGACAAGACAATTGCACTGATCATGACCTCTCTGATCTACTGGACTGCTAGGTGCGACCTTGTCTCATAGAC
TGCCTGGCCGGTAGAAATTCTCGCC

Seq.2 (sequencing primer SR: AGGACAGGTG CCGGCAGCGC)

CCTGGAAATAAGAGGTGAGGTGATCATCAGGTAATGGGGTACTGTCGACGATACCCAATGCTATCAGGAGGCACGT
TATTCAGCGATCTGTCTATTCGGTCATCATAGTTGCTGACTCCCGTCGGTAGATAACTACGATACGGAGGCTACAA
TCTGCCCAGTGCTGCATGATACGCGAGACCACGCTCACCGGCTCAGATTATCAGCATAACAGCAGCGAGGGCCGAG
CGCAGAGTGTCTGCACTTATCCGCTCCATCCAGTCTATAATGTGCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAA
TAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGC
TCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTC
CGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGT
CATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGA
CCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTG
GAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGC
ACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCA
AAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATC
AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACCTC
ACATGTTCTTTCCTGC
GTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCG
CCGCAGCCGAACGACCGAGCGCAGCGAGTCAGAGCGAGTGGGG

Seq.3 pFila sequence

Base pair:                                           6486bp
HSV TK promoter                                    7-759
Chimeric intron                                       826-962
T7 RNA polymerase Promoter (-17 to +2)                  1006-1024
T7 RNA polymerase transcription initiation site              1023
Rluc reporter gene                                     1034-1969
XbaI restriction site                                    1971-1976
ApaI restriction site                                    1995-2000
SV40 late polyadenylation signal(upstream)                 2039-2240
SV40 promoter                                        2279-2481
Fluc reporter gene                                      2511-4163
SV40 late polyadenylation signal(downstream)               4195-4416
Beta-lactamase (AmpR)                                 4800-5660
pBR322 plasmid replication origin                         5802-6445

    1 AGATCTAAAT GAGTCTTCGG ACCTCGCGGG GGCCGCTTAA GCGGTGGTTA
   51 GGGTTTGTCT GACGCGGGGG GAGGGGGAAG GAACGAAACA CTCTCATTCG
  101 GAGGCGGCTC GGGGTTTGGT CTTGGTGGCC ACGGGCACGC AGAAGAGCGC
  151 CGCGATCCTC TTAAGCACCC CCCCGCCCTC CGTGGAGGCG GGGGTTTGGT
  201 CGGCGGGTGG TAACTGGCGG GCCGCTGACT CGGGCGGGTC GCGCGCCCCA
  251 GAGTGTGACC TTTTCGGTCT GCTCGCAGAC CCCCGGGCGG CGCCGCCGCG
  301 GCGGCGACGG GCTCGCTGGG TCCTAGGCTC CATGGGGACC GTATACGTGG
  351 ACAGGCTCTG GAGCATCCGC ACGACTGCGG TGATATTACC GGAGACCTTC
  401 TGCGGGACGA GCCGGGTCAC GCGGCTGACG CGGAGCGTCC GTTGGGCGAC
  451 AAACACCAGG ACGGGGCACA GGTACACTAT CTTGTCACCC GGAGGCGCGA
  501 GGGACTGCAG GAGCTTCAGG GAGTGGCGCA GCTGCTTCAT CCCCGTGGCC
  551 CGTTGCTCGC GTTTGCTGGC GGTGTCCCCG GAAGAAATAT ATTTGCATGT
  601 CTTTAGTTCT ATGATGACAC AAACCCCGCC CAGCGTCTTG TCATTGGCGA
  651 ATTCGAACAC GCAGATGCAG TCGGGGCGGC GCGGTCCCAG GTCCACTTCG
  701 CATATTAAGG TGACGCGTGT GGCCTCGAAC ACCGAGCGAC CCTGCAGCGA
  751 CCCGCTTAAA AGCTTGATTC TTCTGACACA ACAGTCTCGA ACTTAAGCTG
  801 CAGAAGTTGG TCGTGAGGCA CTGGGCAGGT AAGTATCAAG GTTACAAGAC
  851 AGGTTTAAGG AGACCAATAG AAACTGGGCT TGTCGAGACA GAGAAGACTC
  901 TTGCGTTTCT GATAGGCACC TATTGGTCTT ACTGACATCC ACTTTGCCTT
  951 TCTCTCCACA GGTGTCCACT CCCAGTTCAA TTACAGCTCT TAAGGCTAGA
 1001 GTACTTAATA CGACTCACTA TAGGCTAGCC ACCATGACTT CGAAAGTTTA
 1051 TGATCCAGAA CAAAGGAAAC GGATGATAAC TGGTCCGCAG TGGTGGGCCA
 1101 GATGTAAACA AATGAATGTT CTTGATTCAT TTATTAATTA TTATGATTCA
 1151 GAAAAACATG CAGAAAATGC TGTTATTTTT TTACATGGTA ACGCGGCCTC
 1201 TTCTTATTTA TGGCGACATG TTGTGCCACA TATTGAGCCA GTAGCGCGGT
 1251 GTATTATACC AGACCTTATT GGTATGGGCA AATCAGGCAA ATCTGGTAAT
 1301 GGTTCTTATA GGTTACTTGA TCATTACAAA TATCTTACTG CATGGTTTGA
 1351 ACTTCTTAAT TTACCAAAGA AGATCATTTT TGTCGGCCAT GATTGGGGTG
 1401 CTTGTTTGGC ATTTCATTAT AGCTATGAGC ATCAAGATAA GATCAAAGCA
 1451 ATAGTTCACG CTGAAAGTGT AGTAGATGTG ATTGAATCAT GGGATGAATG
 1501 GCCTGATATT GAAGAAGATA TTGCGTTGAT CAAATCTGAA GAAGGAGAAA
 1551 AAATGGTTTT GGAGAATAAC TTCTTCGTGG AAACCATGTT GCCATCAAAA
 1601 ATCATGAGAA AGTTAGAACC AGAAGAATTT GCAGCATATC TTGAACCATT
 1651 CAAAGAGAAA GGTGAAGTTC GTCGTCCAAC ATTATCATGG CCTCGTGAAA
 1701 TCCCGTTAGT AAAAGGTGGT AAACCTGACG TTGTACAAAT TGTTAGGAAT
 1751 TATAATGCTT ATCTACGTGC AAGTGATGAT TTACCAAAAA TGTTTATTGA
 1801 ATCGGACCCA GGATTCTTTT CCAATGCTAT TGTTGAAGGT GCCAAGAAGT
 1851 TTCCTAATAC TGAATTTGTC AAAGTAAAAG GTCTTCATTT TTCGCAAGAA
 1901 GATGCACCTG ATGAAATGGG AAAATATATC AAATCGTTCG TTGAGCGAGT
 1951 TCTCAAAAAT GAACAATAAT TCTAGATTCC GAGATATCGG TAATGGGCCC
 2001 TAGAGCGGCC GCTTCGAGCA GACATGATAA GATACATTGA TGAGTTTGGA
 2051 CAAACCACAA CTAGAATGCA GTGAAAAAAA TGCTTTATTT GTGAAATTTG
 2101 TGATGCTATT GCTTTATTTG TAACCATTAT AAGCTGCAAT AAACAAGTTA
 2151 ACAACAACAA TTGCATTCAT TTTATGTTTC AGGTTCAGGG GGAGGTGTGG
 2201 GAGGTTTTTT AAAGCAAGTA AAACCTCTAC AAATGTGGTA AAATCGATAA
 2251 GGATCCAGGT GGCACTTTTC GTGCGATCTG CATCTCAATT AGTCAGCAAC
 2301 CATAGTCCCG CCCCTAACTC CGCCCATCCC GCCCCTAACT CCGCCCAGTT
 2351 CCGCCCATTC TCCGCCCCAT CGCTGACTAA TTTTTTTTAT TTATGCAGAG
 2401 GCCGAGGCCG CCTCGGCCTC TGAGCTATTC CAGAAGTAGT GAGGAGGCTT
 2451 TTTTGGAGGC CTAGGCTTTT GCAAAAAGCT TGGCATTCCG GTACTGTTGG
 2501 TAAAGCCACC ATGGAAGACG CCAAAAACAT AAAGAAAGGC CCGGCGCCAT
 2551 TCTATCCGCT GGAAGATGGA ACCGCTGGAG AGCAACTGCA TAAGGCTATG
 2601 AAGAGATACG CCCTGGTTCC TGGAACAATT GCTTTTACAG ATGCACATAT
 2651 CGAGGTGGAC ATCACTTACG CTGAGTACTT CGAAATGTCC GTTCGGTTGG
 2701 CAGAAGCTAT GAAACGATAT GGGCTGAATA CAAATCACAG AATCGTCGTA
 2751 TGCAGTGAAA ACTCTCTTCA ATTCTTTATG CCGGTGTTGG GCGCGTTATT
 2801 TATCGGAGTT GCAGTTGCGC CCGCGAACGA CATTTATAAT GAACGTGAAT
 2851 TGCTCAACAG TATGGGCATT TCGCAGCCTA CCGTGGTGTT CGTTTCCAAA
 2901 AAGGGGTTGC AAAAAATTTT GAACGTGCAA AAAAAGCTCC CAATCATCCA
 2951 AAAAATTATT ATCATGGATT CTAAAACGGA TTACCAGGGA TTTCAGTCGA
 3001 TGTACACGTT CGTCACATCT CATCTACCTC CCGGTTTTAA TGAATACGAT
 3051 TTTGTGCCAG AGTCCTTCGA TAGGGACAAG ACAATTGCAC TGATCATGAA
 3101 CTCCTCTGGA TCTACTGGTC TGCCTAAAGG TGTCGCTCTG CCTCATAGAA
 3151 CTGCCTGCGT GAGATTCTCG CATGCCAGAG ATCCTATTTT TGGCAATCAA
 3201 ATCATTCCGG ATACTGCGAT TTTAAGTGTT GTTCCATTCC ATCACGGTTT
 3251 TGGAATGTTT ACTACACTCG GATATTTGAT ATGTGGATTT CGAGTCGTCT
 3301 TAATGTATAG ATTTGAAGAA GAGCTGTTTC TGAGGAGCCT TCAGGATTAC
 3351 AAGATTCAAA GTGCGCTGCT GGTGCCAACC CTATTCTCCT TCTTCGCCAA
 3401 AAGCACTCTG ATTGACAAAT ACGATTTATC TAATTTACAC GAAATTGCTT
 3451 CTGGTGGCGC TCCCCTCTCT AAGGAAGTCG GGGAAGCGGT TGCCAAGAGG
 3501 TTCCATCTGC CAGGTATCAG GCAAGGATAT GGGCTCACTG AGACTACATC
 3551 AGCTATTCTG ATTACACCCG AGGGGGATGA TAAACCGGGC GCGGTCGGTA
 3601 AAGTTGTTCC ATTTTTTGAA GCGAAGGTTG TGGATCTGGA TACCGGGAAA
 3651 ACGCTGGGCG TTAATCAAAG AGGCGAACTG TGTGTGAGAG GTCCTATGAT
 3701 TATGTCCGGT TATGTAAACA ATCCGGAAGC GACCAACGCC TTGATTGACA
 3751 AGGATGGATG GCTACATTCT GGAGACATAG CTTACTGGGA CGAAGACGAA
 3801 CACTTCTTCA TCGTTGACCG CCTGAAGTCT CTGATTAAGT ACAAAGGCTA
 3851 TCAGGTGGCT CCCGCTGAAT TGGAATCCAT CTTGCTCCAA CACCCCAACA
 3901 TCTTCGACGC AGGTGTCGCA GGTCTTCCCG ACGATGACGC CGGTGAACTT
 3951 CCCGCCGCCG TTGTTGTTTT GGAGCACGGA AAGACGATGA CGGAAAAAGA
 4001 GATCGTGGAT TACGTCGCCA GTCAAGTAAC AACCGCGAAA AAGTTGCGCG
 4051 GAGGAGTTGT GTTTGTGGAC GAAGTACCGA AAGGTCTTAC CGGAAAACTC
 4101 GACGCAAGAA AAATCAGAGA GATCCTCATA AAGGCCAAGA AGGGCGGAAA
 4151 GATCGCCGTG TAATTCTTGA GTCGGGGCGG CCGGCCGCTT CGAGCAGACA
 4201 TGATAAGATA CATTGATGAG TTTGGACAAA CCACAACTAG AATGCAGTGA
 4251 AAAAAATGCT TTATTTGTGA AATTTGTGAT GCTATTGCTT TATTTGTAAC
 4301 CATTATAAGC TGCAATAAAC AAGTTAACAA CAACAATTGC ATTCATTTTA
 4351 TGTTTCAGGT TCAGGGGGAG GTGTGGGAGG TTTTTTAAAG CAAGTAAAAC
 4401 CTCTACAAAT GTGGTAAAAT CGATAAGGAT CCGTCGACCG ATGCCCTTGA
 4451 GAGCCTTCAA CCCAGTCAGC TCCTTCCGGT GGGCGCGGGG CATGACTATC
 4501 GTCGCCGCAC TTATGACTGT CTTCTTTATC ATGCAACTCG TAGGACAGGT
 4551 GCCGGCAGCG CTCTTCCGCT TCCTCGCTCA CTGACTCGCT GCGCTCGGTC
 4601 GTTCGGCTGC GGCGAGCGGT ATCAGCTCAC TCAAAGGCGG TAATACGGTT
 4651 ATCCACAGAA TCAGGGGATA ACGCAGGAAA GAACATGTGA GGTGCGCGGA
 4701 ACCCCTATTT GTTTATTTTT CTAAATACAT TCAAATATGT ATCCGCTCAT
 4751 GAGACAATAA CCCTGATAAA TGCTTCAATA ATATTGAAAA AGGAAGAGTA
 4801 TGAGTATTCA ACATTTCCGT GTCGCCCTTA TTCCCTTTTT TGCGGCATTT
 4851 TGCCTTCCTG TTTTTGCTCA CCCAGAAACG CTGGTGAAAG TAAAAGATGC
 4901 TGAAGATCAG TTGGGTGCAC GAGTGGGTTA CATCGAACTG GATCTCAACA
 4951 GCGGTAAGAT CCTTGAGAGT TTTCGCCCCG AAGAACGTTT TCCAATGATG
 5001 AGCACTTTTA AAGTTCTGCT ATGTGGCGCG GTATTATCCC GTATTGACGC
 5051 CGGGCAAGAG CAACTCGGTC GCCGCATACA CTATTCTCAG AATGACTTGG
 5101 TTGAGTACTC ACCAGTCACA GAAAAGCATC TTACGGATGG CATGACAGTA
 5151 AGAGAATTAT GCAGTGCTGC CATAACCATG AGTGATAACA CTGCGGCCAA
 5201 CTTACTTCTG ACAACGATCG GAGGACCGAA GGAGCTAACC GCTTTTTTGC
 5251 ACAACATGGG GGATCATGTA ACTCGCCTTG ATCGTTGGGA ACCGGAGCTG
 5301 AATGAAGCCA TACCAAACGA CGAGCGTGAC ACCACGATGC CTGTAGCAAT
 5351 GGCAACAACG TTGCGCAAAC TATTAACTGG CGAACTACTT ACTCTAGCTT
 5401 CCCGGCAACA ATTAATAGAC TGGATGGAGG CGGATAAAGT TGCAGGACCA
 5451 CTTCTGCGCT CGGCCCTTCC GGCTGGCTGG TTTATTGCTG ATAAATCTGG
 5501 AGCCGGTGAG CGTGGGTCTC GCGGTATCAT TGCAGCACTG GGGCCAGATG
 5551 GTAAGCCCTC CCGTATCGTA GTTATCTACA CGACGGGGAG TCAGGCAACT
 5601 ATGGATGAAC GAAATAGACA GATCGCTGAG ATAGGTGCCT CACTGATTAA
 5651 GCATTGGTAA CTGTCAGACC AAGTTTACTC ATATATACTT TAGATTGATT
 5701 TAAAACTTCA TTTTTAATTT AAAAGGATCT AGGTGAAGAT CCTTTTTGAT
 5751 AATCTCATGA CCAAAATCCC TTAACGTGAG TTTTCGTTCC ACTGAGCGTC
 5801 AGACCCCGTA GAAAAGATCA AAGGATCTTC TTGAGATCCT TTTTTTCTGC
 5851 GCGTAATCTG CTGCTTGCAA ACAAAAAAAC CACCGCTACC AGCGGTGGTT
 5901 TGTTTGCCGG ATCAAGAGCT ACCAACTCTT TTTCCGAAGG TAACTGGCTT
 5951 CAGCAGAGCG CAGATACCAA ATACTGTTCT TCTAGTGTAG CCGTAGTTAG
 6001 GCCACCACTT CAAGAACTCT GTAGCACCGC CTACATACCT CGCTCTGCTA
 6051 ATCCTGTTAC CAGTGGCTGC TGCCAGTGGC GATAAGTCGT GTCTTACCGG
 6101 GTTGGACTCA AGACGATAGT TACCGGATAA GGCGCAGCGG TCGGGCTGAA
 6151 CGGGGGGTTC GTGCACACAG CCCAGCTTGG AGCGAACGAC CTACACCGAA
 6201 CTGAGATACC TACAGCGTGA GCTATGAGAA AGCGCCACGC TTCCCGAAGG
 6251 GAGAAAGGCG GACAGGTATC CGGTAAGCGG CAGGGTCGGA ACAGGAGAGC
 6301 GCACGAGGGA GCTTCCAGGG GGAAACGCCT GGTATCTTTA TAGTCCTGTC
 6351 GGGTTTCGCC ACCTCTGACT TGAGCGTCGA TTTTTGTGAT GCTCGTCAGG
 6401 GGGGCGGAGC CTATGGAAAA ACGCCAGCAA CGCGGCCTTT TTACGGTTCC
 
6451 TGGCCTTTTG CTGGCCTTTT GCTCACATGG CTCGAC