EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2011 by Universidad Católica de Valparaíso -- Chile
Vol. 14 No. 1, Issue of January 15, 2011
 

Table 2. Primer sequences, primer concentrations, product sizes and annealing temperatures.



Abbreviated Gene Designation

Putative Gene Product

Genbank

Forward Primer (F)
Reverse Primer (R)
5’ → 3’

Product Size (Bp)

Annealing Temp (ºC)

Primer
Concentration (Nm)

Ef-Tu

Elongation factor tu

AJ886626

F: TATCCAGAGGGGGATGGTT
R: TGCCTACCTCCCTCTTCCT

102

59

200

ABC transporter ATPase

ABC transporter ATPase

AJ886326

F:TGGCGAAACGTATTGAGAA
R:AGTTGCTGGGGTTAGCATTT

98

59

100

V-ATPase G
subunit 1

V-ATPase G
subunit 1

AJ887447

F: AGATCGGGTGCTAATGTGA
R: AATCCCAGCATCGTTTTTCT

79

59

400

COG complex component

putative conserved oligomeric Golgi (COG) complex component

AJ887962

F:TATCCAACGCCGACAAAATA
R:GGAATGCTTCGATTTTTGCT

105

59

200

H3-K9-HMTase 4

Histone H3-K9 methyltransferase 4

AJ885940

F: GGTGTGAGATCTTGGGATT
R: GTCAAGCCCCTTCATTGTTT

148

59

200

PRK

putative receptor kinase

 
AJ886123
 

F: GTGGTGAGAGAAGAATGGA
R: GCATTTTAGGCCTCTTTTCG

107

59

400

 


Supported by UNESCO / MIRCEN network