EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2010 by Universidad Católica de Valparaíso -- Chile
Vol. 13 No. 1, Issue of January 15, 2010
 


Table 2. Basic information about the different SSR primers used to estimate the genetic distances between eight S6 popcorn lines in Maringá-PR, Brazil.


Locus

Nucleotide Sequences

Number of Alleles

Chromosome

 umc 1241

 TGACACACCCATACTTCCAACAAG (Reverse)

 3

 7

 umc 1241

 TGAAGCAAGTCACTGGTAAGAGCA (Forward)

 

 

 umc 1336

 CTCTGTTTTGGAAGAAGCTTTTGG (Reverse)

 2

 10

 umc 1336

 GTACAAATGATAAGCAAGGGGCAG (Forward)

 

 

 umc 1422

 CTCATCGCGATCTCCCAGTC (Reverse)

 3

 2

 umc 1422

 GAGATAAGCTTCGCCCTGTACCTC (Forward)

 

 

 umc 1495

 TACTGATGGGGGAACGAATAATTG (Reverse)

 3

 3

 umc 1495

 ACACAGCACAACACAACACAACAC (Forward)

 

 

 umc 1636

 GTACTGGTACAGGTCGTCGCTCTT (Reverse)

 4

 9

 umc 1636

 GTACTGGTACAGGTCGTCGCTCTT (Reverse)

 

 

 umc 1656

 GTACGAGCAGGCCATTAACCC (Reverse)

 4

 6

 umc 1656

 AGTTTTGACCGCGCAAAAGTTA (Forward)

 

 

 umc 2227

 AGCTGAGCCTTCTCTTCTTGGCT (Reverse)

 4

 1

 umc 2227

 ACCTTGAGCGTGGAGTCGGT (Forward)

 

 

 umc 2245

 CGTCGTCTTCGACATGTACTTCAC (Reverse)

 3

 2

 umc 2245

 GCCCTGTTATTGGAACAGTTTACG (Forward)

 

 

 umc 2255

 CTGCTGAGGAGAAGTGATCCTGTT (Reverse)

 3

 3

 umc 2255

 GCTACGCTTAAGTATCACGGCAAC (Forward)

 

 

 umc 2262

 CGTTCCCTGGTACCCTGTCTATAA (Reverse)

 4

 3

 umc 2262

 TCTGTTCGGGATTCTTCTTCAGTC (Forward)

 

 

 umc 2292

 ACTTCCGGCATGTCTTGTGTTT (Reverse)

 3

 5

 umc 2292

 AGCAGAAGAGGACAAACCAGATTC (Forward)

 

 

 umc 2302

 CTATACAGCCCTCAGCTCTGCTGT (Reverse)

 2

 5

 umc 2302

 GCATATGCGAGATCATATCGTTGA (Forward)

 

 

 umc 2312

 ACCCCATCTCAGTCTCACTCACTT (Reverse)

 2

 6

 umc 2312

 GCTGATGAGCTCGCCATTCT (Forward)

 

 

 umc 2319

 GATCCACGCGAGGTTCACTG (Reverse)

 2

 6

 umc 2319

 GCTCTCACTAGCCTCGCATTCC (Forward)

 

 

 umc 2343

 GACTGACAACTCAGATTTCACCCA (Reverse)

 3

 9

 umc 2343

 TCATCTTCCCCACAAATTTTCATT (Forward)

 

 

 


Supported by UNESCO / MIRCEN network