EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2008 by Universidad Católica de Valparaíso -- Chile
Vol. 11 No. 5, Special Issue of December 15, 2008
 

Table 2. List of the 48 simple sequence repeat (SSR) markers used in this study. 


Locus

Chr.

Repeat Motif

PRIMER F

PRIMER R

RM110

2

(GA)15

TCGAAGCCATCCACCAACGAAG

TCCGTACGCCGACGAGGTCGAG

RM129

1

(CGG)8

TCTCTCCGGAGCCAAGGCGAGG

CGAGCCACGACGCGATGTACCC

RM134

7

(CCA)7

ACAAGGCCGCGAGAGGATTCCG

GCTCTCCGGTGGCTCCGATTGG

RM144

11

(ATT)11

TGCCCTGGCGCAAATTTGATCC

GCTAGAGGAGATCAGATGGTAGTGCATG

RM148

3

(TG)12

ATACAACATTAGGGATGAGGCTGG

TCCTTAAAGGTGGTGCAATGCGAG

RM165

1

(CT)13

CCGAACGCCTAGAAGCGCGTCC

CGGCGAGGTTTGCTAATGGCGG

RM169

5

GA)12

TGGCTGGCTCCGTGGGTAGCTG

TCCCGTTGCCGTTCATCCCTCC

RM174

2

(AGG)7(GA)10

AGCGACGCCAAGACAAGTCGGG

TCCACGTCGATCGACACGACGG

RM179

12

(TG)7

CCCCATTAGTCCACTCCACCACC

CCAATCAGCCTCATGCCTCCCC

RM186

3

(CGG)5

TCCTCCATCTCCTCCGCTCCCG

GGGCGTGGTGGCCTTCTTCGTC

RM188

5

(CA)8

TCCGCCTCTCCTCTCGCTTCCC

GCAACGCACAACCGAACCGAGC

RM206

11

(CT)21

CCCATGCGTTTAACTATTCT

CGTTCCATCGATCCGTATGG

RM212

1

(CT)24

CCACTTTCAGCTACTACCAG

CACCCATTTGTCTCTCATTATG

RM216

10

(CT)18

GCATGGCCGATGGTAAAG

TGTATAAAACCACACGGCCA

RM239

10

(AG)5TG(AG)2

TACAAAATGCTGGGTACCCC

ACATATGGGACCCACCTGTC

RM262

2

(CT)16

CATTCCGTCTCGGCTCAACT

CAGAGCAAGGTGGCTTGC

RM263

2

(CT)34

CCCAGGCTAGCTCATGAACC

GCTACGTTTGAGCTACCACG

RM272

1

(GA)9

AATTGGTAGAGAGGGGAGAG

ACATGCCATTAGAGTCAGGC

RM286

11

(GA)16

GGCTTCATCTTTGGCGAC

CCGGATTCACGAGATAAACTC

RM296

9

(GA)10

CACATGGCACCAACCTCC

GCCAAGTCATTCACTACTCTGG

RM30

6

(AG)9A(GA)12

GGTTAGGCATCGTCACGG

TCACCTCACCACACGACACG

RM300

2

(GTT)14

GCTTAAGGACTTCTGCGAACC

CAACAGCGATCCACATCATC

RM338

3

(CTT)6

CACAGGAGCAGGAGAAGAGC

GGCAAACCGATCACTCAGTC

RM402

6

(ATA)7

GAGCCATGGAAAGATGCATG

TCAGCTGGCCTATGACAATG

RM408

8

(CT)13

CAACGAGCTAACTTCCGTCC

ACTGCTACTTGGGTAGCTGACC

RM411

3

(GTT)7

ACACCAACTCTTGCCTGCAT

TGAAGCAAAAACATGGCTAGG

RM414

1

(TGCA)6

ATTGCAGTCATGCAGCAGTC

ATATCTCCAATGTGGCAGGG

RM436

7

(TAA)6

ATTCCTGCAGTAAAGCACGG

CTTCGTGTACCTCCCCAAAC

RM441

11

(AG)13

ACACCAGAGAGAGAGAGAGAGAG

TCTGCAACGGCTGATAGATG

RM453

12

(TC)10

CGCATCTCTCTCCCTTATCG

CTCTCCTCCTCGTTGTCGTC

RM471

4

(GA)12

ACGCACAAGCAGATGATGAG

GGGAGAAGACGAATGTTTGC

RM477

8

(AATT)5

TCTCGCGGTATAGTTTGTGC

ACCACTACCAGCAGCCTCTG

RM494

6

(AGA)16

GGGAGGGGATCGAGATAGAC

TTTAACCTTCCTTCCGCTCC

RM495

1

(CTG)7

AATCCAAGGTGCAGAGATGG

CAACGATGACGAACACAACC

RM507

5

(AAGA)7

CTTAAGCTCCAGCCGAAATG

CTCACCCTCATCATCGCC

RM508

6

(AG)17

GGATAGATCATGTGTGGGGG

ACCCGTGAACCACAAAGAAC

RM517

3

(CT)15

GGCTTACTGGCTTCGATTTG

CGTCTCCTTTGGTTAGTGCC

RM519

12

(AAG)8

AGAGAGCCCCTAAATTTCCG

AGGTACGCTCACCTGTGGAC

RM542

7

(CT)22

TGAATCAAGCCCCTCACTAC

CTGCAACGAGTAAGGCAGAG

RM547

8

(ATT)19

TAGGTTGGCAGACCTTTTCG

GTCAAGATCATCCTCGTAGCG

RM551

4

(AG)18

AGCCCAGACTAGCATGATTG

GAAGGCGAGAAGGATCACAG

RM556

8

(CCAG)6

ACTCCAAACCTCACTGCACC

TAGCACACTGAACAGCTGGC

RM559

4

(AACA)6

ACGTACACTTGGCCCTATGC

ATGGGTGTCAGTTTGCTTCC

RM560

7

(CT)12

GCAGGAGGAACAGAATCAGC

AGCCCGTGATACGGTGATAG

RM590

10

(TCT)10

CATCTCCGCTCTCCATGC

GGAGTTGGGGTCTTGTTCG

RM598

5

(GCA)9

GAATCGCACACGTGATGAAC

ATGCGACTGATCGGTACTCC

RM6

2

(AG)16

GTCCCCTCCACCCAATTC

TCGTCTACTGTTGGCTGCAC

RM60

3

(AATT)5AATCT(AATT)

AGTCCCATGTTCCACTTCCG

ATGGCTACTGCCTGTACTAC

 


Supported by UNESCO / MIRCEN network