Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2008 by Universidad Católica de Valparaíso -- Chile
Vol. 11 No. 2, Issue of April 15, 2008
 


Table 1. Primer sequences and PCR conditions.


PCR

Primer

Sequence 5'-3'

PCR conditions

35S
detection

35Spro3
35Spro5

GATAGTGGGATTGTGCGTCA
GCTCCT ACAAATGCCATCA

45s at 94ºC
30s at 53ºC
30s at 72ºC

Genome
walk

AP1
35Spro3

GTAATACGACTCACTATAGGGC
GCTCCTACAAATGCCATCA

45s at 94ºC
30s at 56ºC
3.5m at 72ºC

Non-GM cotton

5cot
3cot

GTAATGTCTAAAATCACGGAGCA
CACCTAATACAAGTCATACATAC

30s at 94ºC
30s at 53ºC
1m at 72ºC

Event 1445

35Spro3
3cot

GCTCCTACAAATGCCATCA
CACCTAATACAAGTCATACATAC


  Supported by UNESCO / MIRCEN network